View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_31 (Length: 313)
Name: NF10821_low_31
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 129 - 290
Target Start/End: Original strand, 38720719 - 38720880
Alignment:
| Q |
129 |
gagattgcttgatagtgctcaagattcttgcagagagtagcttgaatccaaacattactagcagcaataattgttcctccaacagttccaccatacacaa |
228 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38720719 |
gagattgattgatagtggtcaagattcttgcagagagtagcttgaatccaaacattactagcagcaataattgttcctccaacagttccaccatacacca |
38720818 |
T |
|
| Q |
229 |
ctgcaccatgacctgagagtaaaatggaaaaacaagaacaaggtggatgattgagagtatta |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720819 |
ctgcaccatgacctgagagtaaaatggaaaaacaagaacaaggtggatgattgagagtatta |
38720880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 39 - 101
Target Start/End: Original strand, 38720629 - 38720691
Alignment:
| Q |
39 |
gggggaaaattctagtaattcggaaaagttgcaacgtcatcaaaggttgacaaattaacaaca |
101 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720629 |
ggggggaaattctagtgattcggaaaagttgcaacgtcatcaaaggttgacaaattaacaaca |
38720691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University