View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_33 (Length: 300)
Name: NF10821_low_33
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_33 |
 | |
|
| [»] scaffold0090 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0090 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0090
Description:
Target: scaffold0090; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 285
Target Start/End: Original strand, 9956 - 10230
Alignment:
| Q |
11 |
cacagaactattcttgatagtgaacatataatatacctcatcttgattgttgacatattcataatcatatagtgggttttctgtcagttcaattagtcca |
110 |
Q |
| |
|
||||||||||||||||| || |||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||| || | | |||||| ||| |
|
|
| T |
9956 |
cacagaactattcttgagtgtaaacaaataatatacctcatcttgattgttgacaaactcataatcatatagtgggttttcggttaatccaattactccg |
10055 |
T |
|
| Q |
111 |
ctagatcgaggaccggtccatggtcctgttctgtagagtgttgtcgagcctttccaaataaagctttcaggattaggagtcagtaccatagctgaagtaa |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10056 |
ctagatcgaggaccagtccatggtcctgttctgtagagttttgttaagcctttccaaataaagctttcaggattaggagtcagtaccatagctgaagtaa |
10155 |
T |
|
| Q |
211 |
agtcactcgaagatggatcgtcccaatttttccacgcaacaagactcctattaagatcctttcttttgtcccatc |
285 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10156 |
agtcactcgaagatggatcatcccaatttttccacgcaacgagactcctattaagatcctttcttttgtcccatc |
10230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University