View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_35 (Length: 283)
Name: NF10821_low_35
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 7 - 204
Target Start/End: Complemental strand, 1325080 - 1324877
Alignment:
| Q |
7 |
gtgagtttttaaatacccaactttgtgcatgcattcactattattgccattggtgtgcatctattgcattttcttatgatggccgatgtacccgtgctgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1325080 |
gtgagtttttaaatacccaactttgtgcatgcattcactattattg------gtgtgcatctattgcattttcttatgatggccgatgtacccgtgctgt |
1324987 |
T |
|
| Q |
107 |
tacagaaata-----gtattattttcttttttggggttgtgggattgtatatataattcaagtacattc----------tgtcttctcggccttagttca |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| | |||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
1324986 |
tacagaaatagtactgtattattttcttttttggggttgtgggatt---tgtataattctagtacattctgtcttcttttgtcttctcggccttagttca |
1324890 |
T |
|
| Q |
192 |
aggttgtaatgat |
204 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1324889 |
aggttgtaatgat |
1324877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University