View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_36 (Length: 276)
Name: NF10821_low_36
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 50802211 - 50802465
Alignment:
| Q |
1 |
atggtgactcgcgcgacacaattcttacacacatggccagcagcacacaatatgcgcaacaaagatcactgcactgtatgattggtttctctgcgcctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50802211 |
atggtgactcgcgcgacacaattcttacacacatggccagcagcacacaatatgcgcaacaaagatcactgcactgtatgattggtttctctgcgcctgc |
50802310 |
T |
|
| Q |
101 |
ggcatgcagaagtaaaatgcaacatagatgcgaacaatactcaaagatcaaaacggtgtgggtgctggtttttacctgaggaatcatagaggggagaggc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50802311 |
ggcatgcagaagtaaaatgcagcatagatgcgaacagtactcaaagatcaaaacggtgcgggtgctggtttttacctgaggaatcatagaggggagaggc |
50802410 |
T |
|
| Q |
201 |
ttgaggtctgatcttcaagcaatcaaatgaactgtctcaatggttatatattctt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50802411 |
ttgaggtctgatcttcaagcaatcaaatgaactgtctcaatggctatatattctt |
50802465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University