View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_38 (Length: 274)
Name: NF10821_low_38
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 42410061 - 42410302
Alignment:
| Q |
20 |
gtaataataccagttagtttctagcaatctcatccagcttgttgacttgattgtctttgcagccttactttgtagccgagactacaatgcctgggaagag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410061 |
gtaataataccagttagtttctagcaatctcatccagcttgttgacttgattgtctttgcagccttactttgtagccgagactacaatgcctgggaagag |
42410160 |
T |
 |
| Q |
120 |
tgggtttgatttcagaggttcttctcagtcatttaatgtccttgcagagtacctttttggtaaggtagtaatactttttagaaccaagtcacattcgtgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42410161 |
tgggtttgatttcagaggttcttctcagtcatttaatgtccttgcagagtacctttttggtaaggtagtaatactttttagaacaaagtcacattcgtgc |
42410260 |
T |
 |
| Q |
220 |
atttttaaattttactgggttgcttttggttgctgtatctct |
261 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410261 |
attttttaattttactgggttgcttttggttgctgtatctct |
42410302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University