View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_41 (Length: 258)
Name: NF10821_low_41
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 3360567 - 3360349
Alignment:
| Q |
17 |
agcttgagtatgtccaattaaagatttgggtgtaaacttgccatttacaaaaggtttactttttaggttactaaagagactagagaggatttatcttctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3360567 |
agcttgagtatgtccaattaaagatttgggtgtaaacttgccatttacaaaaggtttactttttaggttactaaagagactagagaggatttatcttctt |
3360468 |
T |
|
| Q |
117 |
agcttactaaaggtttactttttgcataatgtgccttgtaaccttttgttaaacttgtctcagccattggacctgattagatannnnnnnnnaatgaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3360467 |
agcttactaaaggtttactttttgcataatgtgccttgtaaccttttgttaaacttgtctcagccattggacctgattagata-ttttttttaatgaagg |
3360369 |
T |
|
| Q |
217 |
aatttctagcaatatctctg |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3360368 |
aatttctagcaatatctctg |
3360349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 194
Target Start/End: Complemental strand, 35906112 - 35906027
Alignment:
| Q |
108 |
tatcttcttagcttactaaaggtttactttttg-cataatgtgccttgtaaccttttgttaaacttgtctcagccattggacctgatt |
194 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |||||||||||||| | |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35906112 |
tatcttcttaggttactaaaggtttaattttttacataatgtgccttgaaccctt--gttaaacttgtctcatccattggacctgatt |
35906027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University