View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_47 (Length: 250)
Name: NF10821_low_47
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 1432984 - 1432804
Alignment:
| Q |
1 |
tttgcattttgccgcaatataaaggtttgcaacgtaactgcgttcgcggccacagtttgaaaccatgagtttgatcactgacaaaaatggaatttcagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1432984 |
tttgcattttgccgcaatataaaggtttgcaacgtaactgcgttcgcggccacagtttgaaaccatgagtttgatcactgacaaaaatggaatttcagaa |
1432885 |
T |
 |
| Q |
101 |
gaaaagnnnnnnngtgttgtgtaataggaaagatagaatctgtgtagaagctatgtcaagcaatcaaaccaggtggaataa |
181 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1432884 |
gaaaagtttttttgtgttgtgtaataggaaagatagaatctgtgaagaagctatgtcaagcaatcaaaccaggtggaataa |
1432804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 38
Target Start/End: Original strand, 37281138 - 37281172
Alignment:
| Q |
4 |
gcattttgccgcaatataaaggtttgcaacgtaac |
38 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
37281138 |
gcattttgccgcaatataaaggtttgcagcgtaac |
37281172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 18573513 - 18573545
Alignment:
| Q |
6 |
attttgccgcaatataaaggtttgcaacgtaac |
38 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
18573513 |
attttaccgcaatataaaggtttgcaacgtaac |
18573545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University