View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_49 (Length: 250)
Name: NF10821_low_49
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 47534025 - 47533790
Alignment:
| Q |
1 |
atgataaattgtgaaacatagttatggactctcatgtgtgtgcatctagaatttcaa--gtctaagtaatttgcaaacaaattcattggtcagtgatttg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534025 |
atgataaattgtgaaacatagttatggactctcatgtgtgtgcatctagaatttcaaaagtctaagtaatttgcaaacaaattcattggtcagtgatttg |
47533926 |
T |
|
| Q |
99 |
ccaaagatttagagtaccatcagatatgtgcaagaattgcttgataggcaagcaacctnnnnnnntttcggcctttgactcctatgagagaacaaaacaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
47533925 |
ccaaagatttagagtaccatcagatatgtgaaagaattgcttgataggcaagcaacctaaaaaaatttcggcctcagactcctatgagagaacaaaacaa |
47533826 |
T |
|
| Q |
199 |
acttgatgtgattcatataataataagtatgtggtccct |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47533825 |
acttgatgtgattcat---ataataagtatgtggtccct |
47533790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University