View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_51 (Length: 249)
Name: NF10821_low_51
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 26 - 239
Target Start/End: Complemental strand, 38790956 - 38790742
Alignment:
| Q |
26 |
taccattggatcgagttagggacattcattttagtccctgatattggacgtatgaattatgacatggcagcagagctttacataactagcttcactaaca |
125 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38790956 |
taccattggattgagttagggacattcattttagtccctgatattggacgtatgaattatgacatggcagcagagctttacataactagcttcactaaca |
38790857 |
T |
|
| Q |
126 |
ttttatggactgaattttcggaaaagcgatctctcaagtttttctcaagacttaatctcaacccataactcacttttctcca-nnnnnnnncgaattcca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||| ||||||||| |
|
|
| T |
38790856 |
ttttatggactgaattttcggaaaagcgatctctcaagtttttctcaagacttaatctcaacccttaactaactcttctccatttttttttcgaattcca |
38790757 |
T |
|
| Q |
225 |
aaattctctcctatg |
239 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38790756 |
aaattctctcctatg |
38790742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University