View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_54 (Length: 247)
Name: NF10821_low_54
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 4 - 228
Target Start/End: Complemental strand, 43315512 - 43315288
Alignment:
| Q |
4 |
atgataatcacattgaccatcagattagtgctccagcttttgatgatgcttggtacaaatcctatgttgctgaaaaacagaaacagaatgagcataacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315512 |
atgataatcacattgaccatcagactagtgctccagcttttgatgatgcttggtacaaatcctatgttgctgaaaaacagaaacagaatgagcataacaa |
43315413 |
T |
|
| Q |
104 |
aaatgcaatttttgtgaggtcattaagccatggcagtggcagaaagtcattgttatttggaagcaaggagatgttggctgctgtgaagattcaaactttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43315412 |
aaatgcaatttttgtgaggtcattaagccatggcagtggcagaaagtcattgttatttggaagcaaagagatgttggctgctgtgaagattcaaactttt |
43315313 |
T |
|
| Q |
204 |
ttcagaggctatttggtatgtgaat |
228 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43315312 |
ttcagaggctatttggtatgtgaat |
43315288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 4609107 - 4609152
Alignment:
| Q |
179 |
ggctgctgtgaagattcaaacttttttcagaggctatttggtatgt |
224 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4609107 |
ggctgctgtaaagattcaaactttcttcagaggctatttggtatgt |
4609152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University