View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_57 (Length: 244)
Name: NF10821_low_57
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 233
Target Start/End: Original strand, 9085305 - 9085524
Alignment:
| Q |
14 |
acatatgttatgagatggattggtttaggcttaccctaaaaaattaaaacaccaagatatttaaagggtaattcacctgctacaaatcccaaagttttag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9085305 |
acatatgttatgagatggattggtttaggcttaccctaaaaaattaaaacaccaagatatttaaagggtaattcacctgctacaaatcccaaagttttag |
9085404 |
T |
|
| Q |
114 |
cagtatcagttttctcggataatggccaagagcatgagtaacaatttagagaact-atgtgccccccaaatgtttcaccatactgtcttaacagaaccat |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9085405 |
cagtatcagttttcttggataatggccaagagcatgagtaa-aatttagagaactaatgtgccccccaaatgtttcaccatactaccttaacagaaccat |
9085503 |
T |
|
| Q |
213 |
tatagagttcagatacttctt |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9085504 |
tatagagttcagatacttctt |
9085524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University