View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_59 (Length: 242)
Name: NF10821_low_59
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 42089326 - 42089532
Alignment:
| Q |
20 |
ggtgagtgatctcaaagaaacataactgagacggcacggcacacattgggaagatttcagttggagcataataattaaatatatatgatgagtttggaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089326 |
ggtgagtgatctcaaagaaacataactgggacggcacggcacacattgggaagatttcagttggagcataataattaaatatatatgatgagtttggaaa |
42089425 |
T |
|
| Q |
120 |
attagctttgaagattaataaaatacattttgtgcattcacgtggtcataataaacctgttggttatgaattatgcacatgaagacttcatcttttttcg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089426 |
attagctttgaagattaataaaatacattttgtgcattcacgtgatcataataaacctgttggttatgaattatgcacatgaagacttcatcttttttcg |
42089525 |
T |
|
| Q |
220 |
ggttcat |
226 |
Q |
| |
|
||||||| |
|
|
| T |
42089526 |
ggttcat |
42089532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University