View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_60 (Length: 242)
Name: NF10821_low_60
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 43901672 - 43901886
Alignment:
| Q |
18 |
gatttgttgtgtgagattgtacttcctgttttaaggatatcacgtaactatggcggtgtaatgctgtggacaacacactatgataaacaaagtggataca |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901672 |
gatttgttgtgtgagattgtagttcctgttttaaggatatcgcgtaactatggcggtgtaatgctgtggacaacacactatgataaacaaagtggataca |
43901771 |
T |
|
| Q |
118 |
gcaactacataaaaagttctctatgcacacaacaaaagtctcctgaatgtggaggaaattattattgtcgccacaaaggttctttttatagactaaactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
43901772 |
gcaactacataaaaagttctctatgcacacaacaaaagtctcctgaatgtggaggaaattattattgtagccacacaggttctttttatagactaaactt |
43901871 |
T |
|
| Q |
218 |
ggtcgtagttctctg |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43901872 |
ggtcgtagttctctg |
43901886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University