View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_62 (Length: 241)
Name: NF10821_low_62
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 38790971 - 38791065
Alignment:
| Q |
1 |
tttttaaatttcctcctgttctttcatgtctcctttacgagcgacacttacttgagcacaaacctgaataaaaattatttagatgcacacacatc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
38790971 |
tttttaaatttcctcctgttctttcatgtctcctttacgagcaacatttacttgagcacaaacctaaataaaaattatttagatgcacatacatc |
38791065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 95
Target Start/End: Complemental strand, 14152701 - 14152647
Alignment:
| Q |
39 |
gagcgacacttacttgagcacaaacctgaataaaaattatttagatgcacacacatc |
95 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14152701 |
gagcaacacttacttgggcacaaacctaaataaaaattatttaga--cacacacatc |
14152647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University