View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_71 (Length: 238)
Name: NF10821_low_71
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 32875496 - 32875293
Alignment:
| Q |
19 |
atgtgctcatgaaacaagcaggcgtggtagctagtcccatatcgaacaccatacagccagcacgagaaagaccggcaaacactgcaacgctcaatttcga |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32875496 |
atgtgctcatgaaacaagcgggcgtggtagctagtcccatatcgaacaccatacaaccagcacgagcaagaccggcaaacactgcaacgctcaatttcga |
32875397 |
T |
 |
| Q |
119 |
ccctgtaactcgagggtcccgtccaagagacacactcacattctcaacaggatatcctttttccttctctaaaccattgataacccactccccaaaactc |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875396 |
ccctgtaactcgagggtcacgtccaagagacacactcacattctcaacaggatatcctttttccttctctaaaccattgataacccactccccaaaactc |
32875297 |
T |
 |
| Q |
219 |
tctg |
222 |
Q |
| |
|
|||| |
|
|
| T |
32875296 |
tctg |
32875293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University