View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_72 (Length: 237)
Name: NF10821_low_72
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 7949937 - 7950158
Alignment:
| Q |
2 |
cctccacaatttttggagcattaggagtgtgagtttcaattctgaaagctttcaaaaccacaaagtctctgattgttgggctagttactgcagatataag |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7949937 |
cctccacaatttttggagcattaggaatgtgagtttcaattctgaaagctttcaaaaccacaaagtctctgattgctgggctagttactgcagatataag |
7950036 |
T |
|
| Q |
102 |
gttaccagataggttcacacttgcaatgatcatgtttttagctgcaactaaatttggtttgacattgttgaatttgaagttgtttctagagaaccatatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7950037 |
gttaccagataggttcacacttgcaatgatcatgtttttagctgcaactaaatttggtttgacattgttgaatttgaagttgtttctagagaaccatatg |
7950136 |
T |
|
| Q |
202 |
acatttatggtattgataaaag |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7950137 |
acatttatggtattgataaaag |
7950158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University