View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_73 (Length: 236)
Name: NF10821_low_73
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 11181227 - 11181032
Alignment:
| Q |
15 |
cataggtagtgtcacgggtttatacatgttcaaaatagacggtagaaaaagtaacactaggagtgacatgcggaacaagaaaactatagagaatttcacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181227 |
cataggtagtgtcacgggtttatacatgttcaaaatagacagtagaaaaagtaacactaggagtgacatgcggaacaagaaaactatagagaatttcacc |
11181128 |
T |
|
| Q |
115 |
tgcggggtttgtttgggacaggacaggtccagggcattcaaacaaaacaatagtaaaaacagaacacaatagtgcatgcagatgcaggtgatagat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181127 |
tgcggggtttgtttgggacaggacaggtccagggcattcaaacaaagcaatagtaaaaacagaacacaatagtgcatgcagatgcaggtgatagat |
11181032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University