View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_81 (Length: 218)
Name: NF10821_low_81
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 12888809 - 12888997
Alignment:
| Q |
15 |
gaagaagttaaaatagaa-gtacaccaaaccaaa---tattagatttgagtttgacaagtctttctaggcatcatgtgacgtgtagaaaatacgaaaatg |
110 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12888809 |
gaagaagttagaatagaaagtacaccaaaccaaaagatattagatttgagtttgacaagtctttctaggcatcatgtgacatgtagaaaatacgaaaatg |
12888908 |
T |
|
| Q |
111 |
cagaaaaaagcctgtccaatccagctctttattttgaaaggatcccttcaagaaaccggttttattacaagttattgccataccaagcat |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12888909 |
cagaaaa-agcctgtccaatccagctctttattttgaaaggatcccttcaagaaaccggttttattacaagttattgccataccaagcat |
12888997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 130 - 200
Target Start/End: Original strand, 12891277 - 12891347
Alignment:
| Q |
130 |
tccagctctttattttgaaaggatcccttcaagaaaccggttttattacaagttattgccataccaagcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
12891277 |
tccagctctttattttgaaaggatcccttgaatgaaccggttttaatacaagttattgccttaacaagcat |
12891347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University