View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_85 (Length: 206)
Name: NF10821_low_85
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 46 - 193
Target Start/End: Complemental strand, 25348531 - 25348384
Alignment:
| Q |
46 |
ctcaaatcagttgagctaccaaccccctaaaataagccgtgaaaaataagcatagaccatatgtatgtgtatgttattttttaactagttatttagctca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25348531 |
ctcaaatcagttgagctaccaaccccctaaaataagccgtgaaaaataagtatagaccgtatgtatgtgtatgttattttttaattagttatttagctca |
25348432 |
T |
|
| Q |
146 |
atgatcgattaatttagaagaccaatctcacactccgaatgatgtcca |
193 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
25348431 |
atgaccgattaatttagaagatcaatctcacacttcgagtgatgtcca |
25348384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University