View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_86 (Length: 204)
Name: NF10821_low_86
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 10436228 - 10436054
Alignment:
| Q |
13 |
cataggctagtgaatttggattattttccagctcatatgagatatttcatgttctcaagttgttgtaaaatatgtgactactcaaataccaacaaggcaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10436228 |
cataggctagtgaatttggattattttccagctcatatgagatatttcatgttctcaagttgttgtaaaatatgtgactactcaaataccaacaaggcaa |
10436129 |
T |
 |
| Q |
113 |
tcttataaattatcacnnnnnnncatgggatc--atacttgtggacccaatacatatatatatctttggtgaaaaa |
186 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
10436128 |
tcttataaattatcactttttttcatgggatcatatactcgtggacccaacac-tatatatatctttggtgaaaaa |
10436054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University