View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_87 (Length: 201)
Name: NF10821_low_87
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_87 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 152965 - 153134
Alignment:
| Q |
16 |
gatgggtcggtggtgggataacatacgacatgtggtggtattttcagggataacagaggatctttaatgagttgttttgcaggtaatcttggagcattct |
115 |
Q |
| |
|
|||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
152965 |
gatgggtcggtggtgggacaacatgcggcatgtggtggtattttcagggataacagaggatctttaatgacttgttttgcaggtaatcttgaagcattct |
153064 |
T |
|
| Q |
116 |
caatttttgaggccaaaatctttggttttattatggctatggaaaacgctctgcagcaaggttacatttg |
185 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
153065 |
ctgtttttgaggtcaaaatctttggttttattatggctatggagaacgctctgcaacaaggttacatttg |
153134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 16 - 158
Target Start/End: Complemental strand, 41444254 - 41444112
Alignment:
| Q |
16 |
gatgggtcggtggtgggataacatacgacatgtggtggtattttcagggataacagaggatctttaatgagttgttttgcaggtaatcttggagcattct |
115 |
Q |
| |
|
||||||||||||||| || ||||| |||||||||||||||||| ||||| || ||||||||||| ||| |||| |||||||||||| ||||||| |||| |
|
|
| T |
41444254 |
gatgggtcggtggtgagacaacatgtgacatgtggtggtatttttagggacaatagaggatctttgatgggttgatttgcaggtaatattggagccttct |
41444155 |
T |
|
| Q |
116 |
caatttttgaggccaaaatctttggttttattatggctatgga |
158 |
Q |
| |
|
| ||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
41444154 |
ctgtttttgaggccgaaatctttggttatgctatggctatgga |
41444112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 45 - 158
Target Start/End: Original strand, 32879424 - 32879537
Alignment:
| Q |
45 |
atgtggtggtattttcagggataacagaggatctttaatgagttgttttgcaggtaatcttggagcattctcaatttttgaggccaaaatctttggtttt |
144 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||| ||| | ||||||||||||||||||||||||||||| ||||||| ||| |||||||| ||||| |
|
|
| T |
32879424 |
atgtggtggtatttttagggacaacagagggtctttgatgggatgttttgcaggtaatcttggagcattctctgtttttgatgccgaaatcttttgtttt |
32879523 |
T |
|
| Q |
145 |
attatggctatgga |
158 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32879524 |
attatggctatgga |
32879537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University