View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10822_high_2 (Length: 372)
Name: NF10822_high_2
Description: NF10822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10822_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 7 - 350
Target Start/End: Complemental strand, 13245619 - 13245276
Alignment:
| Q |
7 |
gtagcaaaggatgatactttctcaattagaaaaagttagagcaatacatcatgcaaattagaaaaattttgtggtagtcctaatccacgaacaatctgta |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13245619 |
gtagctaaggatgatactttctcaattagaaaaagttagagcaatacatcatgcaatttagaaaaattttatggtagtcctaatccacgaacaatctgta |
13245520 |
T |
 |
| Q |
107 |
taggaccaatgaacccggccctcgtaatgttcttgcagtattggaggaaaccaccaaaaaatttctgactgtcatttatccggtgtgtccttgatcctta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13245519 |
taggaccaatgaacccggccctcgtaatgttcttgcagtattggaggaaaccaccaaaaaaattctgaatgtcatttatccggtgtgtccttgatcctta |
13245420 |
T |
 |
| Q |
207 |
gaaggccgccaacattccttccttttcgacggctttttggccttagcagcggctgatgacagccagaaatacagttatttcttgtagtgatggtcaccat |
306 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13245419 |
gaaggccgccaaaattccttccttttcgacggctttttggccttaccagcggcttatgacagccagaaatacagttatttcttgtagtgatggtcaccct |
13245320 |
T |
 |
| Q |
307 |
gtgtcactaaagttttattttgcgtaagagtttcatagcttata |
350 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13245319 |
gtgtcactaaagttttattttgcgcaagagtttcatagcttata |
13245276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 273 - 344
Target Start/End: Complemental strand, 13266638 - 13266567
Alignment:
| Q |
273 |
aaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaagagtttcatag |
344 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13266638 |
aaatatagttatttcttgtagtgatggtcactctgtgtcactaaagttttattttgcgtaagagtttcatag |
13266567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University