View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10822_high_9 (Length: 224)
Name: NF10822_high_9
Description: NF10822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10822_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 38658881 - 38658837
Alignment:
| Q |
144 |
gttgaaattttagatctgagatgagagacaaataatggaaagaag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38658881 |
gttgaaattttagatctgagatgagagacaaataatggaaagaag |
38658837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 11 - 60
Target Start/End: Complemental strand, 38659015 - 38658965
Alignment:
| Q |
11 |
aagcagagaggatgaactcaatcca-caaatctgaaccggatcgattgggg |
60 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38659015 |
aagcagtgaggatgaactcaatccaacaaatctgaaccggatcgattgggg |
38658965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University