View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10822_low_16 (Length: 240)
Name: NF10822_low_16
Description: NF10822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10822_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 9874098 - 9873896
Alignment:
| Q |
21 |
atggtactcgtttaattttaagtagtttattctaaaaaatagtattttgaatatttgttatcgtagtgaagaaacttactcgcaaaaatcacgacaagtt |
120 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9874098 |
atggtactcgtataattttaagtagtttattctaaaaaatagtatttcgaatatttgttatcgtagtgaagaaacttactcgcaaaaatcacgacaagtt |
9873999 |
T |
 |
| Q |
121 |
cagagtttcaaatcacttgaaggaagnnnnnnnntcaatcagttctttgaatgaaaacaaaggtgagtgagcaaagaaattgtgctacgtcgttcgcttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9873998 |
cagagtttcaaatcacttgaaggaagaaaaaaaatcaatcagttctttgaatgaaaacaaaggtgagtgagcaaagaaattgtgctacgtcgttcgctat |
9873899 |
T |
 |
| Q |
221 |
cat |
223 |
Q |
| |
|
||| |
|
|
| T |
9873898 |
cat |
9873896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University