View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10823_low_3 (Length: 309)
Name: NF10823_low_3
Description: NF10823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10823_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 4 - 218
Target Start/End: Original strand, 52947692 - 52947907
Alignment:
| Q |
4 |
ttgacggtgaatcacggcaacaaagtgtaatcgatggtcaacgaaggtttgtgaaggtgatcgacggtagaagaagcggtttttggcttgcgattgaggt |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | || | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52947692 |
ttgacggtgaatcacggcaacgaagtgtaatcaacagttagcgaaggtttttgaaggtgatcgacggtagaagaagcggtttttggcttgcgattgaggt |
52947791 |
T |
|
| Q |
104 |
agaacatttttttcatatcctct--gnnnnnnnnncttgttatattttgtttgttgtttgaatcaaaaaatctttgaatgttagtttgtaatgatgtaaa |
201 |
Q |
| |
|
|||||| || | | |||||||| ||| |||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
52947792 |
agaaca-ttctaacctatcctcttatttttttcttcttcttatcttttgtttgttgtttgaatcaaaaaatctttgaatgctagtttataatgatgtaaa |
52947890 |
T |
|
| Q |
202 |
agagtagaatggatgtc |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52947891 |
agagtagaatggatgtc |
52947907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 309
Target Start/End: Original strand, 52947969 - 52947998
Alignment:
| Q |
280 |
gtagagacgaagatgaaggtttattaacaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52947969 |
gtagagacgaagatgaaggtttattaacaa |
52947998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University