View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10825_high_2 (Length: 304)
Name: NF10825_high_2
Description: NF10825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10825_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 160 - 294
Target Start/End: Original strand, 33077354 - 33077488
Alignment:
| Q |
160 |
gactctaatgctcataagtagaaactgtttctagaccggttttcttatggttaggaagcatttgcgtgttctgttcgtacccgactgtttttgcggctct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33077354 |
gactctaatgctcataagtagaaactgtttctagaccggttttcttatggttaggaagcatttgcgtgttctgttcatacccgactgtttttgcggctct |
33077453 |
T |
 |
| Q |
260 |
gctgttccggtattttgccaagtttcacacctttg |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
33077454 |
gctgttccggtattttgctaagtttcacacctttg |
33077488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 41500723 - 41500776
Alignment:
| Q |
15 |
aaaagcaaatacaccaccttcaaaacagaaaactctaactccctagtacctcca |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41500723 |
aaaagcaaatacaccaccttcaaaacagaaaactctaactccctagtacctcca |
41500776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 14 - 60
Target Start/End: Original strand, 33077209 - 33077255
Alignment:
| Q |
14 |
caaaagcaaatacaccaccttcaaaacagaaaactctaactccctag |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33077209 |
caaaagcaaatacaccaccttcaaaacagaaaactctaactccctag |
33077255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University