View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10825_high_3 (Length: 250)

Name: NF10825_high_3
Description: NF10825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10825_high_3
NF10825_high_3
[»] chr3 (1 HSPs)
chr3 (7-234)||(25515628-25515855)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 25515628 - 25515855
Alignment:
7 ggagcagagataaagttgatgatcttggttttggagcaaggtataggacattgaattcaatattgtattggattgattgtatgagagatgagaaggtgat 106  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25515628 ggagtagagataaagttgatgatcttggttttggagcaaggtataggacattgaattcaatattgtattggattgattgtatgagagatgagaaggtgat 25515727  T
107 tccttaatttagag--tgtttttccgcatcagtttccgatctactaatggtgagcgactaatccagttcgatatgtagaagcatgtacactggccaaata 204  Q
    ||||||||||||||  | ||||| ||||||||||||||||| |||||||||||||||||||||||  || ||| ||||||||||||||||| |||||| |    
25515728 tccttaatttagagttttttttttcgcatcagtttccgatccactaatggtgagcgactaatccaactc-atacgtagaagcatgtacactagccaaaca 25515826  T
205 tttttctccctagtaatcgaattcggtatt 234  Q
    || ||| |||||||||| |||  |||||||    
25515827 ttgttc-ccctagtaatagaacccggtatt 25515855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University