View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10825_high_3 (Length: 250)
Name: NF10825_high_3
Description: NF10825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10825_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 25515628 - 25515855
Alignment:
| Q |
7 |
ggagcagagataaagttgatgatcttggttttggagcaaggtataggacattgaattcaatattgtattggattgattgtatgagagatgagaaggtgat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25515628 |
ggagtagagataaagttgatgatcttggttttggagcaaggtataggacattgaattcaatattgtattggattgattgtatgagagatgagaaggtgat |
25515727 |
T |
 |
| Q |
107 |
tccttaatttagag--tgtttttccgcatcagtttccgatctactaatggtgagcgactaatccagttcgatatgtagaagcatgtacactggccaaata |
204 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||||||||| ||||||||||||||||||||||| || ||| ||||||||||||||||| |||||| | |
|
|
| T |
25515728 |
tccttaatttagagttttttttttcgcatcagtttccgatccactaatggtgagcgactaatccaactc-atacgtagaagcatgtacactagccaaaca |
25515826 |
T |
 |
| Q |
205 |
tttttctccctagtaatcgaattcggtatt |
234 |
Q |
| |
|
|| ||| |||||||||| ||| ||||||| |
|
|
| T |
25515827 |
ttgttc-ccctagtaatagaacccggtatt |
25515855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University