View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10825_low_6 (Length: 238)
Name: NF10825_low_6
Description: NF10825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10825_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 25515869 - 25516081
Alignment:
| Q |
1 |
cttggaaggagctctttgcctccttaattagagtcttgtgttgaaacatatttgacttttgatttggagtgctggtattagaaatttatggagcaccaca |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
25515869 |
cttgaaaggagctctttgcctccttaattagagtcttgt--tgcaacatatttgacttttgatttggagtgttgatattagaaatttatggagcaccaca |
25515966 |
T |
|
| Q |
101 |
aaatgggctttttcataaataaattagtggaaacgtgtttttgcatgtgcttgttaaaatttccctttattgttccttagttttctatagtttctataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25515967 |
aaatgggctttttcataaataaattagtggcaacgtgtttttgcatgtgcttgttaaaatttccctttattgttccttagttttctatagtttctataat |
25516066 |
T |
|
| Q |
201 |
ttaataataatgtat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25516067 |
ttaataataatgtat |
25516081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University