View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10826_high_5 (Length: 241)
Name: NF10826_high_5
Description: NF10826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10826_high_5 |
 |  |
|
| [»] chr1 (19 HSPs) |
 |  |
|
| [»] chr8 (15 HSPs) |
 |  |
|
| [»] chr4 (22 HSPs) |
 |  |
|
| [»] chr7 (19 HSPs) |
 |  |
|
| [»] chr3 (26 HSPs) |
 |  |
|
| [»] chr2 (13 HSPs) |
 |  |
|
| [»] chr5 (9 HSPs) |
 |  |
|
| [»] scaffold0565 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
| [»] scaffold2107 (1 HSPs) |
 |  |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 5463998 - 5463775
Alignment:
| Q |
19 |
atgtgagtaacatgtgtttcacaattttttataaccaaatttcttcttagcttcgccggtgaataacatgatcagaaaatcat--gtcatggaaaacttg |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5463998 |
atgtgagtaacatgtgtttcacatttttttataaccaattttcttcttagcttcactggtgaataacatgatcagaaaatcatatgtcatggaaaacttg |
5463899 |
T |
 |
| Q |
117 |
attcaaatcaagatgccacgtgtcgataatttcttacgagatttgcatttccataaataaatttgaagaaaaccctcaaatatatgctcatccgtttcaa |
216 |
Q |
| |
|
||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5463898 |
attcatatcaaggtgccacgtgtcgatcatttcttacgagatttgcatttccataaataaatttgaagaaaaccctcaaatatactc-catccgtttcaa |
5463800 |
T |
 |
| Q |
217 |
aatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
5463799 |
aatgagtgtcgctttagccaattgc |
5463775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 48259782 - 48259816
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48259782 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
48259816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 10843016 - 10842980
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10843016 |
catccgtttcaaaatgagtgtcgttttagtcaattgc |
10842980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 206 - 237
Target Start/End: Original strand, 26755180 - 26755211
Alignment:
| Q |
206 |
atccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26755180 |
atccgtttcaaaatgagtgtcgttttagccaa |
26755211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 210 - 241
Target Start/End: Original strand, 28751330 - 28751361
Alignment:
| Q |
210 |
gtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28751330 |
gtttcaaaatgagtgtcgttttagccaattgc |
28751361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 205 - 240
Target Start/End: Original strand, 52125051 - 52125086
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattg |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52125051 |
catccgttttaaaatgagtgtcgttttagccaattg |
52125086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 2458969 - 2458999
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2458969 |
tccgtttcaaaatgagtgtcgttttagccaa |
2458999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 2459239 - 2459205
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2459239 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
2459205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 7375250 - 7375280
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7375250 |
tccgtttcaaaatgagtgtcgttttagccaa |
7375280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 241
Target Start/End: Original strand, 11134383 - 11134413
Alignment:
| Q |
211 |
tttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11134383 |
tttcaaaatgagtgtcgttttagccaattgc |
11134413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 13408253 - 13408287
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13408253 |
tccgttttaaaatgagtgtcgttttagccaattgc |
13408287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 48009244 - 48009210
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48009244 |
tccgtttcaaaatgagtgtcgttttagtcaattgc |
48009210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 48319924 - 48319958
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48319924 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
48319958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 241
Target Start/End: Complemental strand, 40719251 - 40719214
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40719251 |
tcatccgttttgaaatgagtgtcgttttagccaattgc |
40719214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 1740557 - 1740589
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
1740557 |
tccgtttcaaaatgaatgtcgttttagccaatt |
1740589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 15573845 - 15573813
Alignment:
| Q |
209 |
cgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
15573845 |
cgtttcaaaatgaatgtcgttttagccaattgc |
15573813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 27720918 - 27720950
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
27720918 |
catccgtttcaaaatgagtgtcgctttagccaa |
27720950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Complemental strand, 32807128 - 32807100
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32807128 |
tccgtttcaaaatgagtgtcgttttagcc |
32807100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 49426334 - 49426370
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
49426334 |
catccgtttcaaaatgagtgtcgctttaggcaattgc |
49426370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 4530102 - 4530066
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4530102 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
4530066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 13765468 - 13765521
Alignment:
| Q |
136 |
gtgtcgataatttcttacgagatttgcatttccataaataaatttgaagaaaac |
189 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |||||| |||||| |
|
|
| T |
13765468 |
gtgtcgatcatttcttgtgagatttgcatttccataaatacatttgaggaaaac |
13765521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 18673292 - 18673260
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18673292 |
catccgtttcaaaatgagtgtcgttttagccaa |
18673260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 9022629 - 9022595
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9022629 |
tccgttttaaaatgagtgtcgttttagccaattgc |
9022595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 34168398 - 34168368
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34168398 |
tccgtttcaaaatgagtgtcgttttagccaa |
34168368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 39463220 - 39463250
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39463220 |
tccgtttcaaaatgagtgtcgttttagccaa |
39463250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 39463491 - 39463457
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39463491 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
39463457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 39698857 - 39698827
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39698857 |
tccgtttcaaaatgagtgtcgttttagccaa |
39698827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 396142 - 396170
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
396142 |
catccgtttcaaaatgagtgtcgttttag |
396170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 4760476 - 4760512
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
4760476 |
catccgttttaaaatgagtgtcgctttagccaattgc |
4760512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 8382404 - 8382440
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
8382404 |
catccgttttaaaatgagtgtcgttttagctaattgc |
8382440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 8471490 - 8471458
Alignment:
| Q |
209 |
cgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
8471490 |
cgtttcaaaatgagtgtcgctttagccaattgc |
8471458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 27109737 - 27109765
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27109737 |
catccgtttcaaaatgagtgtcgttttag |
27109765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 34168131 - 34168163
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
34168131 |
tccgtttcaaaatgagtgtcgctttagccaatt |
34168163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 41790057 - 41790093
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
41790057 |
catccgtttcaaaataaatgtcgttttagccaattgc |
41790093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 22)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 206 - 241
Target Start/End: Complemental strand, 45889796 - 45889761
Alignment:
| Q |
206 |
atccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889796 |
atccgtttcaaaatgagtgtcgttttagccaattgc |
45889761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 37654644 - 37654610
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37654644 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
37654610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 2493338 - 2493302
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2493338 |
catccgtttcaaaatgagtgtcgtttttgccaattgc |
2493302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 2728319 - 2728355
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2728319 |
catccgtttcaaaatgagtgtcgctttagccaattgc |
2728355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 6462248 - 6462212
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6462248 |
catccgtttcaaaatgagggtcgttttagccaattgc |
6462212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 32140796 - 32140832
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32140796 |
catccgtttcaaaatgagtgtcgttttagtcaattgc |
32140832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 54042103 - 54042139
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54042103 |
catccgttttaaaatgagtgtcgttttagccaattgc |
54042139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 239
Target Start/End: Original strand, 29519445 - 29519480
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29519445 |
tcatccgttttaaaatgagtgtcgttttagccaatt |
29519480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 24941114 - 24941080
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
24941114 |
tccgtttcaaaatgagtgtcgttttaaccaattgc |
24941080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 29840285 - 29840251
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
29840285 |
tccgtttcaaaatgagtgtcgttttacccaattgc |
29840251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 30492950 - 30492916
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30492950 |
tccgtttcaaaatgagtgtggttttagccaattgc |
30492916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 31941787 - 31941753
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31941787 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
31941753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 34124527 - 34124493
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34124527 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
34124493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 39985051 - 39985017
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39985051 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
39985017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 47321377 - 47321343
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47321377 |
tccgttttaaaatgagtgtcgttttagccaattgc |
47321343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 47817697 - 47817727
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47817697 |
tccgtttcaaaatgagtgtcgttttagccaa |
47817727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 52957713 - 52957747
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52957713 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
52957747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 54234048 - 54234014
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54234048 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
54234014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 233
Target Start/End: Original strand, 22220290 - 22220319
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22220290 |
tcatccgtttcaaaatgagtgtcgttttag |
22220319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 241
Target Start/End: Complemental strand, 27653911 - 27653874
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
27653911 |
tcatctgtttcaaaatgagtgtcgctttagccaattgc |
27653874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 40010793 - 40010821
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40010793 |
catccgtttcaaaatgagtgtcgttttag |
40010821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 55126731 - 55126695
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
55126731 |
catccgttttaaaatgaatgtcgttttagccaattgc |
55126695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 19)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 40299072 - 40299038
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40299072 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
40299038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 204 - 241
Target Start/End: Original strand, 33056200 - 33056237
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33056200 |
tcatccgtttcaaaatgagtgtcgttttagtcaattgc |
33056237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 32346030 - 32345998
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32346030 |
catccgtttcaaaatgagtgtcgttttagccaa |
32345998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 205 - 240
Target Start/End: Original strand, 7795158 - 7795193
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattg |
240 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7795158 |
catccgtttcaaaatgagtgtcgctttagccaattg |
7795193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 210 - 241
Target Start/End: Complemental strand, 22298232 - 22298201
Alignment:
| Q |
210 |
gtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22298232 |
gtttcaaaatgagtgtcgttttagccaattgc |
22298201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 1742225 - 1742191
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1742225 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
1742191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 19906648 - 19906614
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19906648 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
19906614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 32345753 - 32345787
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32345753 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
32345787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 37815958 - 37815924
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37815958 |
tccgttttaaaatgagtgtcgttttagccaattgc |
37815924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 44453367 - 44453333
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44453367 |
tccgttttaaaatgagtgtcgttttagccaattgc |
44453333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 715789 - 715818
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
715789 |
catccgtttcaaaatgagtgtcgttttagc |
715818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 233
Target Start/End: Complemental strand, 18270804 - 18270775
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18270804 |
tcatccgtttcaaaatgagtgtcgttttag |
18270775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 207 - 240
Target Start/End: Complemental strand, 36836306 - 36836273
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattg |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
36836306 |
tccgtttcaaaatcagtgtcgttttagccaattg |
36836273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 37502279 - 37502308
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37502279 |
catccgtttcaaaatgagtgtcgttttagc |
37502308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 237
Target Start/End: Complemental strand, 45500016 - 45499987
Alignment:
| Q |
208 |
ccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45500016 |
ccgtttcaaaatgagtgtcgttttagccaa |
45499987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 1741953 - 1741981
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1741953 |
tccgtttcaaaatgagtgtcgttttagcc |
1741981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 5723222 - 5723186
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
5723222 |
catccgttttaaaatgagtgtcgttttagtcaattgc |
5723186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 27936003 - 27935971
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
27936003 |
catccgtttcaaaatgagtgtcgctttagccaa |
27935971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 40207304 - 40207340
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
40207304 |
catccgtttcaaaatgagtgttgctttagccaattgc |
40207340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 26)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 44648329 - 44648363
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44648329 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
44648363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 16240803 - 16240767
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16240803 |
catccgtttcaaaatgagtgtcgttttagcctattgc |
16240767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 38016335 - 38016367
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38016335 |
catccgtttcaaaatgagtgtcgttttagccaa |
38016367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 42791532 - 42791496
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42791532 |
catccgtttcaaaatgagtgtcattttagccaattgc |
42791496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 43736788 - 43736824
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43736788 |
catccgtttcaaaatgagtgtcgctttagccaattgc |
43736824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 44854549 - 44854513
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44854549 |
catccgtttcaaaatgattgtcgttttagccaattgc |
44854513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 2988527 - 2988561
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2988527 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
2988561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 4392129 - 4392095
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4392129 |
tccgtttcaaaatgagtgtcgttttggccaattgc |
4392095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 20512687 - 20512657
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20512687 |
tccgtttcaaaatgagtgtcgttttagccaa |
20512657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 23525232 - 23525266
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
23525232 |
tccgtttcaatatgagtgtcgttttagccaattgc |
23525266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 38364025 - 38363991
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38364025 |
tccgttttaaaatgagtgtcgttttagccaattgc |
38363991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 51398244 - 51398210
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51398244 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
51398210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 52222769 - 52222803
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52222769 |
tccgtttcaaaattagtgtcgttttagccaattgc |
52222803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 54261377 - 54261407
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54261377 |
tccgtttcaaaatgagtgtcgttttagccaa |
54261407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 44645299 - 44645328
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44645299 |
catccgtttcaaaatgagtgtcgttttagc |
44645328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 241
Target Start/End: Complemental strand, 45567033 - 45566996
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
45567033 |
tcatccgttttaaaatgagtgtcattttagccaattgc |
45566996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 2567929 - 2567965
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2567929 |
catccgttttaaaatgaatgtcgttttagccaattgc |
2567965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 25061929 - 25061893
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
25061929 |
catccgtttaaaaatgagtgtcgttttagccgattgc |
25061893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Complemental strand, 30186409 - 30186377
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
30186409 |
tccgttttaaaatgagtgtcgttttagccaatt |
30186377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 31290893 - 31290925
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
31290893 |
tccgttttaaaatgagtgtcgttttagccaatt |
31290925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 36729686 - 36729722
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
36729686 |
catctgtttcaaaatgagcgtcgttttagccaattgc |
36729722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 41287412 - 41287444
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41287412 |
tccgtttcaaaatgagtgtcgctttagccaatt |
41287444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Complemental strand, 44676455 - 44676423
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
44676455 |
tccgtttcaaaatgagtgttgttttagccaatt |
44676423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 51397969 - 51398001
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
51397969 |
catccgttttaaaatgagtgtcgttttagccaa |
51398001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Complemental strand, 54261651 - 54261619
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
54261651 |
tccgtttcaaaatgagtgtcgctttagccaatt |
54261619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 54933120 - 54933156
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
54933120 |
catccgttttaaaatgagtgtcgctttagccaattgc |
54933156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 441150 - 441184
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
441150 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
441184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 203 - 241
Target Start/End: Complemental strand, 34225987 - 34225949
Alignment:
| Q |
203 |
ctcatccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34225987 |
ctcatccgtttcaaaatgagtgtcgctttagccaattgc |
34225949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 210 - 241
Target Start/End: Original strand, 29396602 - 29396633
Alignment:
| Q |
210 |
gtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29396602 |
gtttcaaaatgagtgtcgttttagccaattgc |
29396633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 4132985 - 4133015
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4132985 |
tccgtttcaaaatgagtgtcgttttagccaa |
4133015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 4133256 - 4133222
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4133256 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
4133222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 239
Target Start/End: Complemental strand, 7743636 - 7743602
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7743636 |
catccgtttcaaaatgagtgtcgctttagccaatt |
7743602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 12342327 - 12342293
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12342327 |
tccgttttaaaatgagtgtcgttttagccaattgc |
12342293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 43388576 - 43388610
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43388576 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
43388610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Complemental strand, 4840919 - 4840891
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4840919 |
catccgtttcaaaatgagtgtcgttttag |
4840891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 13561952 - 13561984
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
13561952 |
catccgtttcaaaatgagtgtcattttagccaa |
13561984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 14698221 - 14698189
Alignment:
| Q |
209 |
cgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
14698221 |
cgtttcaaaatgagtgtcgctttagccaattgc |
14698189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 25383402 - 25383438
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
25383402 |
catccgttttaaaatgagtgtcgctttagccaattgc |
25383438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 29809049 - 29809013
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
29809049 |
catctgtttcaaaatgagtgtcgctttagccaattgc |
29809013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 204 - 241
Target Start/End: Original strand, 38982070 - 38982107
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38982070 |
tcatccgtttcaaaatgaatgtcgttttagccaattgc |
38982107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 14620688 - 14620656
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14620688 |
catccgtttcaaaatgagtgtcgttttagccaa |
14620656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 21375842 - 21375812
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21375842 |
tccgtttcaaaatgagtgtcgttttagccaa |
21375812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 24436459 - 24436493
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24436459 |
tccgttttaaaatgagtgtcgttttagccaattgc |
24436493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Original strand, 42103982 - 42104016
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42103982 |
tccgtttcaaaatgagtgtcgctttagccaattgc |
42104016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 42104256 - 42104226
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42104256 |
tccgtttcaaaatgagtgtcgttttagccaa |
42104226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 237
Target Start/End: Complemental strand, 40330902 - 40330873
Alignment:
| Q |
208 |
ccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40330902 |
ccgtttcaaaatgagtgtcgttttagccaa |
40330873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 2729703 - 2729739
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2729703 |
catccgtttcaaaatgattgtcgctttagccaattgc |
2729739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 42661861 - 42661893
Alignment:
| Q |
209 |
cgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
42661861 |
cgtttcaaaatgagtgtcgctttagccaattgc |
42661893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 9579 - 9611
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9579 |
tccgtttcaaaatgagtgtcgttttagccaatt |
9611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 240
Target Start/End: Complemental strand, 158325 - 158289
Alignment:
| Q |
204 |
tcatccgtttcaaaatgagtgtcgttttagccaattg |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
158325 |
tcatccgttttaaaatgagtgtcgttttagccaattg |
158289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 70646 - 70616
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
70646 |
tccgtttcaaaatgagtgtcgttttagccaa |
70616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Complemental strand, 17246797 - 17246767
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17246797 |
tccgtttcaaaatgagtgtcgttttagccaa |
17246767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 29927169 - 29927199
Alignment:
| Q |
207 |
tccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29927169 |
tccgtttcaaaatgagtgtcgttttagccaa |
29927199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 234257 - 234225
Alignment:
| Q |
209 |
cgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
234257 |
cgtttcaaaatgagtgtcgttttaaccaattgc |
234225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 24163630 - 24163666
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaattgc |
241 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
24163630 |
catccgttttaaagtgagtgtcgttttagccaattgc |
24163666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 32429245 - 32429277
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
32429245 |
catccgttttaaaatgagtgtcgttttagccaa |
32429277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2107 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold2107
Description:
Target: scaffold2107; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 706 - 674
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
706 |
catccgtttcaaaatgaatgtcgttttagccaa |
674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 24934 - 24902
Alignment:
| Q |
205 |
catccgtttcaaaatgagtgtcgttttagccaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
24934 |
catccgtttcaaaatgagtgtcgttttatccaa |
24902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University