View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10826_high_7 (Length: 227)
Name: NF10826_high_7
Description: NF10826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10826_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 24 - 225
Target Start/End: Original strand, 42443517 - 42443718
Alignment:
| Q |
24 |
taataagttttgtcaaaagtgaaaaaattaataggtctaactaatacaaataaaacatatattaacaacaactggtcatggctacaatgcaaacattgca |
123 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
42443517 |
taataagttttgtcgaaagtgaaaaaaataataggtctaactaatacaaataaaacatatattaataacaactggtcatggctacaaagcaaacattgca |
42443616 |
T |
|
| Q |
124 |
ctatctgcctgtcatgtcctcattcatctctagatgcacgtgaaggtgaacatgtttatttcatcataggagcttaaaacttgagactaatctattcgaa |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| ||||| |
|
|
| T |
42443617 |
ctatctgcttgtcatgtcctcattcatctctagatgcacgtgaaggtgaacatgtttatttcatcatagaagcttaaaatttgagattaatctactcgaa |
42443716 |
T |
|
| Q |
224 |
at |
225 |
Q |
| |
|
|| |
|
|
| T |
42443717 |
at |
42443718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University