View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10826_low_12 (Length: 225)

Name: NF10826_low_12
Description: NF10826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10826_low_12
NF10826_low_12
[»] chr5 (2 HSPs)
chr5 (142-207)||(36265951-36266016)
chr5 (15-78)||(36265824-36265887)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 142 - 207
Target Start/End: Original strand, 36265951 - 36266016
Alignment:
142 gcagcagaaccttcattatactacaccttaatcaaaacagcaaataatacaaaaaacattacataa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36265951 gcagcagaaccttcattatactacaccttaatcaaaacagcaaataatacaaaaaacattacataa 36266016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 36265824 - 36265887
Alignment:
15 cacagattcaccagatgtggctattgtagccgaaccttcatttggatccacctaatcaaaacac 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36265824 cacagattcaccagatgtggctattgtagccgaaccttcatttggatccacctaatcaaaacac 36265887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University