View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10826_low_14 (Length: 215)
Name: NF10826_low_14
Description: NF10826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10826_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 79 - 197
Target Start/End: Complemental strand, 4409280 - 4409162
Alignment:
| Q |
79 |
cattgatacagtgtatagtgtttggtgcagtgccactcatttctgtttcaggctttagagggcccatcttttcactctctctctgatcatttatctgaat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409280 |
cattgatacagtgtatagtgtttggtgcagtgccactcatttctgtttcaggctttagagggcccatcttttcactctctctctgatcatttatctgaat |
4409181 |
T |
|
| Q |
179 |
cactgctatatttcactct |
197 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4409180 |
cactgctatatttcactct |
4409162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University