View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10827_low_11 (Length: 218)
Name: NF10827_low_11
Description: NF10827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10827_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 36581857 - 36582042
Alignment:
| Q |
19 |
caccacacaagcatttttcagagttaaaaaagtaaaataaatcaattcacacaactaggacacgtgaaatattttggcaaaattcatataaattttgata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36581857 |
caccacacaagcatttttcagagttaaaaaagtaaaataaatcaattcacacaactatgacacatgaaatattttggcaaagttcatataaattttgata |
36581956 |
T |
 |
| Q |
119 |
tgaaattgctaagatgattacccttcaacattttgctcagtgcaaaagtcacggaaggaaatgcaggctttctgaactctctgtgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36581957 |
tgaaattgctaagatgattacccttcaacattttgctcagtgcaaaagtcacggaaggaaatgcaggctttctgaactctctgtgc |
36582042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University