View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10828_low_2 (Length: 380)
Name: NF10828_low_2
Description: NF10828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10828_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 4e-88; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 51 - 245
Target Start/End: Complemental strand, 40471072 - 40470881
Alignment:
| Q |
51 |
actaaatctatagcctgaagtttatacataatagcttcatgagtttgcaatatataacttcatattatttgcaatgttttattaaaaactggatcaaaaa |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
40471072 |
actaaatctatagcctgaagtttatacataatagcttcatgagtttgcaatatataacttcatataatttgcaatgtttta---aaaactggatcaaaaa |
40470976 |
T |
 |
| Q |
151 |
gacagcttcaactgtgaaccagccagttcgttggttggtttcattccagttatgctatagtctggttgaagcagattaaaatagagttgaaccag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40470975 |
gacagcttcaactgtgaaccagccagttcgttggttggtttcattccggttatactatagtcaggttgaagcagattaaaatagagttgaaccag |
40470881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 283 - 369
Target Start/End: Complemental strand, 40470843 - 40470757
Alignment:
| Q |
283 |
gtgtcatccagttcaaccatgattcggatgtttcattgattcaatcccttttctgagtttttattttaaatcattggttatttgtga |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40470843 |
gtgtcatccagttcaaccatgattcggatgtttcattgattcaatctcttgtctgagtttttattttaaatcattggttatttgtga |
40470757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 40471130 - 40471095
Alignment:
| Q |
1 |
gcagaggaagatgactctagaagtaaaagaaggtga |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40471130 |
gcagaggaagatgactctagaagtaaaagaaggtga |
40471095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University