View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_high_13 (Length: 437)
Name: NF10829A_high_13
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 8 - 430
Target Start/End: Complemental strand, 172201 - 171762
Alignment:
| Q |
8 |
tgagatgaataattgggcagctttctgggaaacttcttgccattttctttgatgttggaggaataagtccaaccatgatgatggattttttcttccatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
172201 |
tgagatgaataattgggcagctttctgggaaacttcttgccattttctttgatgttggaggaataagtccaaccatgatgatggattttttcttccatct |
172102 |
T |
|
| Q |
108 |
agaccgtggcaggatgtgattacaagagtgctactaaaatgtagcgaaaggtgcctatatggcgaagaatttaatgggtgcctcctcttattgattggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
172101 |
agaccgtggcaggatgtgattacaagagtgctactaaaatgtagcgaaaggtgcctatatggcgaagaatttaatgggtgcctcctcttattgattggat |
172002 |
T |
|
| Q |
208 |
taaattgagtacatatggat------------------gagaaaggtgtggtggtaattggatgtgatttctcaaaagttcttgggtttttgtagtgctt |
289 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
172001 |
taaattgagtacatatggtttgtcaaaggataatggtagagaaaggtgtggtggtaattggatgtgatttctc-aaagttcttgggttcttgtagtgctt |
171903 |
T |
|
| Q |
290 |
atatggcggagttatggagggtgttgaaaggtttgaagttggcttgctctcgaggttttactaggattgaactctggattcaaaggtggtggctatgtcg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
171902 |
atatggcggagttatggagggtgttgaaaggtttgaagttggctcgctctcgaggttttactaggtttgaactctggattcaaaggtggttgctatgtcg |
171803 |
T |
|
| Q |
390 |
ttaaacagtcgacaatgtagcatgatatagattggtaaagc |
430 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
171802 |
ttaaacagtcgacaatgttgcatgatatagattggtaaagc |
171762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University