View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_high_17 (Length: 362)
Name: NF10829A_high_17
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 12 - 321
Target Start/End: Complemental strand, 10436422 - 10436113
Alignment:
| Q |
12 |
atagatggatatataagggatcaaaggctatggttgtatccaaatccaatgaaacatctttggagaaaatgattcatcaaagatcatccaccacctgatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10436422 |
atagatggatatataagggatcaaaggctatggttgtatccaaatccaatgaaacatctttggagaaaatgattcatcaaagatcatccaccacctgatt |
10436323 |
T |
 |
| Q |
112 |
tggtctagttagtgaatatggcttctctctttgtggagccctgcatgcaattggaaggacttctttaccaaagcatcacttcaacaacgtagaccatagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10436322 |
tggtctagttagtgaatatggcttctctctttgtggagccctacatgcaattggaaggacttctttaccaaagcatcacttcaacaacatagaccatagg |
10436223 |
T |
 |
| Q |
212 |
ctagtgaatttggattattttccagctcatatgagatatttcatgttctcaagttgttgtaaaatatgtgactactcaaataccaacaaggcaatcttat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10436222 |
ctagtgaatttggattattttccagctcatatgagatatttcatgttctcaagttgttgtaaaatatgtgactactcaaataccaacaaggcaatcttat |
10436123 |
T |
 |
| Q |
312 |
aaattatcac |
321 |
Q |
| |
|
|||||||||| |
|
|
| T |
10436122 |
aaattatcac |
10436113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University