View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_high_29 (Length: 249)
Name: NF10829A_high_29
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_high_29 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 249
Target Start/End: Complemental strand, 31610128 - 31609903
Alignment:
| Q |
23 |
gatacatattgctaatcaaatgtatgattgggctagattcatttgagttagtttgtcacttttatagtatttctaactatgaaaatagggtaatttctta |
122 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31610128 |
gatacatagtgctaatcaaatgtatgattgggctagattcatttgagttagtttgtcacttttatagtatttctaactatgaaaatagggtaatttctta |
31610029 |
T |
 |
| Q |
123 |
tcgcttctgcctttctcctccaccaaattgatattttggattctatcttttgaatgggtaaaaacatgaaaaatctatttttactcttggattttagaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31610028 |
tcgcttctgcctttctcctccaccaaattgatattttggattctatcttttgaatgggtaaaaacatg-aaaatctatttttactcttggattttagaat |
31609930 |
T |
 |
| Q |
223 |
ccaaaaagtagggtgcacaaccaattg |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31609929 |
ccaaaaagtagggtgcacaaccaattg |
31609903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University