View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_102 (Length: 364)
Name: NF10829A_low_102
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 22 - 358
Target Start/End: Complemental strand, 7753083 - 7752747
Alignment:
| Q |
22 |
tcagggattgagccggttagctggttttgacatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggctagataagttgataa |
121 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
7753083 |
tcagggattgagccggttaactggttttgaaatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaa |
7752984 |
T |
|
| Q |
122 |
tgtttatgtagagttgttctaggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttagt |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7752983 |
tgtatatgtagagttgttctaggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttggt |
7752884 |
T |
|
| Q |
222 |
gagtcgacctagtgatgcagggatttggccggtaaacctgttcccggagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattggg |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752883 |
gagtcgacctagtgatgcagggatttggccggtaaacctgttcccagagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattggg |
7752784 |
T |
|
| Q |
322 |
ccggtgagactgtccaagctaaagtcgaggtggacaa |
358 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7752783 |
cctgtgagactgtccaagctaaagtcgaggtgaacaa |
7752747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University