View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_126 (Length: 340)
Name: NF10829A_low_126
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_126 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 142 - 264
Target Start/End: Complemental strand, 46711759 - 46711637
Alignment:
| Q |
142 |
ggagggtccagtgaatatccttaccctcgcaggggaagaactaatagaccacccgcaaagtcaggttcggcttttccacaatgatcaccagtttaataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46711759 |
ggagggtccagtgaatatccttaccctcgcaggggaagaactaatagaccacccgcaaagtcaggttcggcttttccacaatgatcaccagtttaataat |
46711660 |
T |
|
| Q |
242 |
tatttactcgcaattaatatatt |
264 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46711659 |
tatttactcgcaattaatatatt |
46711637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 153 - 183
Target Start/End: Original strand, 36923644 - 36923674
Alignment:
| Q |
153 |
tgaatatccttaccctcgcaggggaagaact |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36923644 |
tgaatatccttaccctcgcaggggaagaact |
36923674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University