View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_164 (Length: 317)
Name: NF10829A_low_164
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_164 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 12 - 299
Target Start/End: Original strand, 8883551 - 8883837
Alignment:
| Q |
12 |
gaaatgaaaaattgttcaatggttttactatgtacctgtagatgccttcactcttggggcatgagcagtttaggatgttttcctttgtcttgtactatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8883551 |
gaaatgaaaaattgttcaatggttttactatgtacctgtagatgccttcactcttggggcatgagcagtttaggatgttttcttttgtcttgtactatat |
8883650 |
T |
|
| Q |
112 |
actacgtaatcaatgattcaatgcccaccatactacgtatgattattactctttacagataaaaaataactagaaaataccaaaatcatataactttgta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8883651 |
actacgtaatcaatgattcaatgcccactatactacgtatgattattactctttacagataaaaaataactag-aaataccaaaatcatataaatttgta |
8883749 |
T |
|
| Q |
212 |
agaatattttgctgttgtctcagaattgttgcatcatttactaactcattattttaattgcatcatacaatcagaagcatgttcttct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883750 |
agaatattttgctgttgtctcagaattgttgcatcatttactaactcattattttaattgcatcatacaatcagaagcatgttcttct |
8883837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University