View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_168 (Length: 315)
Name: NF10829A_low_168
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_168 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 9 - 177
Target Start/End: Original strand, 32907349 - 32907519
Alignment:
| Q |
9 |
gatatgaatgaataaatcaatgaaaatcctgacaaaatactctcactttat--cctatattatgtgtgaaccactcaataatcctcccattaattgtcac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
32907349 |
gatatgaatgaataaatcaatgaaaatcctgacaaaatactctcactttatatcctatattatgtatgaaccactcaataatcctcccactaattgtcac |
32907448 |
T |
|
| Q |
107 |
tcctctcttggttagcaaatcagcagaattgttggcttccctattcactcctctcttttgtattttctgtc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32907449 |
tcctctcttggttagcaaatcagcagaattgttggcttccctgttcactcctctcttttgtattttctgtc |
32907519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 191 - 308
Target Start/End: Original strand, 32907580 - 32907697
Alignment:
| Q |
191 |
tgtagcatgtcttaaaacttaatatattaaaccttatatggagggtattctgccattggatggatttgcttccaggtaactgtaatgaaatactactggc |
290 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32907580 |
tgtagcatgtcttaaaacttaatgtattaaactttatatggagggtattcttccattggatggatttgcttccaggtaattgtaatgaaatactactggc |
32907679 |
T |
|
| Q |
291 |
tttacactattgaaatct |
308 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
32907680 |
tttatactatcgaaatct |
32907697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University