View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10829A_low_179 (Length: 309)

Name: NF10829A_low_179
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10829A_low_179
NF10829A_low_179
[»] chr8 (1 HSPs)
chr8 (142-221)||(33203860-33203939)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 142 - 221
Target Start/End: Original strand, 33203860 - 33203939
Alignment:
142 gttgctgattttgaaattgaacttggaattcaatatgcttctcttatgaaagagattgctgaaaaagctgttaacggttc 221  Q
    |||| ||||||||||||||  |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
33203860 gttgttgattttgaaattggtcttggaattcaatacgcttctcttatgaaagagattgctgaaaaagctgttaacggttc 33203939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University