View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_207 (Length: 284)
Name: NF10829A_low_207
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_207 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 11 - 280
Target Start/End: Complemental strand, 43408374 - 43408104
Alignment:
| Q |
11 |
cacagaaacaggtgcagatgatgactcctgctgaaggtagtggttttgagtgtgaattagggctgatctcctcctcataggtacccatatctgaataagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408374 |
cacagaaacaggtgcagatgatgactcctgctgaaggtagtggttttgagtgtgaattagggctgatctcctcctcataggtacccatatctgaataagg |
43408275 |
T |
 |
| Q |
111 |
acgttgttggatgagttctttgtgtactcttttaagtaaccaacagcaa-cactaatctttctttgacagatgttgttggacctggatttgccctaggcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408274 |
acgttgttggatgagttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacagatgttgttggacctggatttgccctaggcc |
43408175 |
T |
 |
| Q |
210 |
caatccaccatctcttcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408174 |
caatccaccatctcttcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtg |
43408104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University