View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_213 (Length: 282)
Name: NF10829A_low_213
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_213 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 105 - 276
Target Start/End: Original strand, 40003482 - 40003645
Alignment:
| Q |
105 |
ttgctatagtatctatcgtctacctttcaattttccacatgtatgtatattctttgaacattctcatggcgtgcctaatagagtggtgtttgcaggaagt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40003482 |
ttgctatagtatctatcgtctacctttcaattttccacatgtatgtatattctttgaacattctcatggcgtgcctaatagagtggtaattgcaggaagt |
40003581 |
T |
|
| Q |
205 |
tgcttgaatgtggcaatctggcaatctttgatgtgtaattttagtgcttttcttaaagataagagcaaaatc |
276 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40003582 |
tgcttgaatg--------tggcaatctttgatgtgtaattttagtgcttttcttaaagataagagcaaaatc |
40003645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 5 - 89
Target Start/End: Original strand, 40003409 - 40003494
Alignment:
| Q |
5 |
agtttttgtccattatattttctgaaatannnnnnn-attgtcttactttgatgtttttcattcccttgctaattgctatagtatc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40003409 |
agtttttgtccattatattttctgaaatatgttttttattgtcttaccttgatgtttttcattcccttgttaattgctatagtatc |
40003494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University