View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_231 (Length: 273)
Name: NF10829A_low_231
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_231 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 7 - 266
Target Start/End: Complemental strand, 3447239 - 3446980
Alignment:
| Q |
7 |
caaacgtattttgacttcacaaggattcatttctggatcaggtttttcttcttgatcaatttatatttgacttggattcttaccatattttcctattgac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447239 |
caaacgtattttgacttcacaaggattcatttctggatcaggtttttcttcttgatcaatttatatttgacttggattcttaccatattttcctattgac |
3447140 |
T |
|
| Q |
107 |
aaattgttgttcaaaatgtattacatgatagtggagataaatgaagggaagatagtttctattgttgaaggatatggcaagaaggataattctgtgcatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3447139 |
aaattgttgttcaaaatgtattacatgatagtggagataaacgaagggaagatagtttctattgttgaaggttatggcaagaaggataattctgtgcatc |
3447040 |
T |
|
| Q |
207 |
aagtgattgattatggagatgctgttgtcatgcctggcttgattgatgtgtaagatgtca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447039 |
aagtgattgattatggagatgctgttgtcatgcctggcttgattgatgtgtaagatgtca |
3446980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University