View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_234 (Length: 271)
Name: NF10829A_low_234
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_234 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 14147887 - 14147652
Alignment:
| Q |
1 |
agtgtggcgaaatcatttgggaccacaagccctttcgactcaacaattgttggcttggtcatgaagtgtcgaacaagaattaatgcacacttttggaagc |
100 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14147887 |
agtgtggcgaaatcatttgggcccccaagccctttcgactcaacaattgttggcttggtcatgaagtgtcgaacaagaattaatgcacacttttggaagc |
14147788 |
T |
|
| Q |
101 |
aggttaggttcaaggagagcctgcttagacaaaaatcaaggtatcattagatcaatgtgggaaacactaaaacaaggtatctcaaatctggttggagtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14147787 |
aggttaggttcaaggagagcctgcttagacaaaaatcaaggtatcattagatcaatgcgggaaacactaaaacaaggtatctcaaatctggttggagtct |
14147688 |
T |
|
| Q |
201 |
cttggataaggatattgtgggttttatgaataaatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14147687 |
cttggataaggatattgtgggttttatgaataaatt |
14147652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University