View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_254 (Length: 260)
Name: NF10829A_low_254
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_254 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 24 - 260
Target Start/End: Complemental strand, 52302736 - 52302500
Alignment:
| Q |
24 |
agcattatcgttgtagctttgaactaatggtttagaagttgaatttgcctcatcagtagaaatcaaaatctgatcagaactaagaagaccctttccgtta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302736 |
agcattatcgttgtagctttgaactaatggtttagaagttgaatttgcctcatcagtagaaatcaaaatctgatcagaactaagaagaccctttccgtta |
52302637 |
T |
|
| Q |
124 |
agcaagtttttatagtaatgattatcaaagagatcagttgagttcctatcaagaactgcagttgtgtttccatccccagtttgaggacacaaattttgta |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302636 |
agcaagttcttatagtaatgattatcaaagagatcagttgagttcctatcaagaactgcagttgtgtttccatccccagtttgaggacacaaattttgta |
52302537 |
T |
|
| Q |
224 |
ggtcggttagcataccggtttccagtgtactgtctgg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302536 |
ggtcggttagcataccggtttccagtgtactgtctgg |
52302500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University