View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_264 (Length: 257)
Name: NF10829A_low_264
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_264 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 38322839 - 38322595
Alignment:
| Q |
1 |
ttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcatcactttcgacaagtcgatatcctttgttttctttcagctgcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322839 |
ttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcattactttcgacaagtcgatatcctttgttttctttcagctgcaca |
38322740 |
T |
 |
| Q |
101 |
aatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatttagtatagaaaaatgaacctgcacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38322739 |
aatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatatagtatagaaaaatgaacctgcacttt |
38322640 |
T |
 |
| Q |
201 |
ttgccaatcagggttgtactttatggctaacacatattgttggag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38322639 |
ttgccaatcagggttgtactttatggctaacacattttgttggag |
38322595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University