View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_279 (Length: 252)
Name: NF10829A_low_279
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_279 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 6e-83; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 10 - 200
Target Start/End: Complemental strand, 13879885 - 13879697
Alignment:
| Q |
10 |
aagaaaatctcactctgtcaactgtcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcg |
109 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879885 |
aagaaaatctcact--gtcaactgttaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcg |
13879788 |
T |
|
| Q |
110 |
ccaccgccccttcgctactgccgccatgtctctggttaccatctcctacgctgctcctcgactcattcactatttcaacaccaatgagctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13879787 |
ccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgccactccacgactcattcgctatttcaacaccaatgagctg |
13879697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 34 - 197
Target Start/End: Complemental strand, 13875640 - 13875477
Alignment:
| Q |
34 |
tcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| ||| |||||| ||||||||||| || ||||||||| || |||| ||||||||||||| |
|
|
| T |
13875640 |
tcaacacaatggcattttcccgcctcctctcttcctgctaccgctcattcatggccgccgtgccttcactcattcgccgccaccccgtcgctactgccgc |
13875541 |
T |
|
| Q |
134 |
catgtctctggttaccatctcctacgctgctcctcgactcattcactatttcaacaccaatgag |
197 |
Q |
| |
|
|||||| || || ||||||||||| | || |||| |||||||| ||||||||||||||||||| |
|
|
| T |
13875540 |
catgtcactcgtagccatctcctacaccgcacctccactcattcgctatttcaacaccaatgag |
13875477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 70
Target Start/End: Complemental strand, 13885756 - 13885720
Alignment:
| Q |
34 |
tcaacacaatggcattttcccgcctcctttcttcctc |
70 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
13885756 |
tcaacacaatggcattttcccgcttcctctcttcctc |
13885720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University