View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_280 (Length: 252)
Name: NF10829A_low_280
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_280 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 44952232 - 44952462
Alignment:
| Q |
8 |
cagagacagatgcaatcaaaactcacgtagtcactctactcgatcgatgtccatatatgtgacacacaaaacaacataggagtgttgcatggtagcttct |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44952232 |
cagagacagatgcaatcaaaactcatgtagtcattctactcgatcgatgtccatatatgtgacacacaaaacaacataggagt--tgcatggtagcttct |
44952329 |
T |
|
| Q |
108 |
gacatcgtgaattaagtactgcctatgtcacttaggaattcccctctcattgttctcatgtgatccaacaaatagatccacatctagtgtgtttgtgttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952330 |
gacatcgtgaattaagtactgcctatgtcacttaggaattcccctctcattgttctcatgtgatccaacaaatagatccacatctagtgtgtttgtgttc |
44952429 |
T |
|
| Q |
208 |
cccgcacttaggtttgtcaagatatgatgacca |
240 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |
|
|
| T |
44952430 |
cccacacttaggtttgtcaagatatgatgacca |
44952462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University